ID: 1066180457_1066180477

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1066180457 1066180477
Species Human (GRCh38) Human (GRCh38)
Location 10:32957510-32957532 10:32957563-32957585
Sequence CCCCGGTCCCCAGCGGCTCCACT CCGCCCGCGGCGCTGGCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 253} {0: 1, 1: 0, 2: 3, 3: 36, 4: 413}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!