ID: 1066220835_1066220845

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1066220835 1066220845
Species Human (GRCh38) Human (GRCh38)
Location 10:33335421-33335443 10:33335445-33335467
Sequence CCTGCCCAGAGCTGGAGGGCGAG AGGGGAAAGCCGGGCTGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 30, 4: 313} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!