ID: 1066230147_1066230148

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1066230147 1066230148
Species Human (GRCh38) Human (GRCh38)
Location 10:33424234-33424256 10:33424251-33424273
Sequence CCAGACACTGTGAAGCAGAGACA GAGACAAGCCATCCTCTCTATGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 14, 3: 69, 4: 369} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!