ID: 1066270619_1066270626

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1066270619 1066270626
Species Human (GRCh38) Human (GRCh38)
Location 10:33819491-33819513 10:33819516-33819538
Sequence CCCAGTAAAAAAATAAGACAAAA CCAGGCTGCCTGGCAAGAAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 39, 4: 347}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!