ID: 1066430558_1066430562

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1066430558 1066430562
Species Human (GRCh38) Human (GRCh38)
Location 10:35347127-35347149 10:35347154-35347176
Sequence CCTTATTGGGGATGTGTAGTGGG CAGACACATTGTCCCGTACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 97} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!