ID: 1066437358_1066437381

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1066437358 1066437381
Species Human (GRCh38) Human (GRCh38)
Location 10:35406863-35406885 10:35406896-35406918
Sequence CCCCCCCCCACCTCCGTCCCCGT GGCCAGGCAGAGGGGCTTTTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 12, 3: 450, 4: 1610} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!