ID: 1066437359_1066437378

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1066437359 1066437378
Species Human (GRCh38) Human (GRCh38)
Location 10:35406864-35406886 10:35406887-35406909
Sequence CCCCCCCCACCTCCGTCCCCGTC GGGGCGGCCGGCCAGGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 33, 3: 1287, 4: 2119} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!