ID: 1066437359_1066437378 |
View in Genome Browser |
Spacer: 0 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1066437359 | 1066437378 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 10:35406864-35406886 | 10:35406887-35406909 |
Sequence | CCCCCCCCACCTCCGTCCCCGTC | GGGGCGGCCGGCCAGGCAGAGGG |
Strand | - | + |
Off-target summary | {0: 1, 1: 0, 2: 33, 3: 1287, 4: 2119} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |