ID: 1066437365_1066437384

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1066437365 1066437384
Species Human (GRCh38) Human (GRCh38)
Location 10:35406868-35406890 10:35406915-35406937
Sequence CCCCACCTCCGTCCCCGTCGGGG TTGGAGCTTTTTCTAATGTCGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!