ID: 1066437368_1066437377

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1066437368 1066437377
Species Human (GRCh38) Human (GRCh38)
Location 10:35406870-35406892 10:35406886-35406908
Sequence CCACCTCCGTCCCCGTCGGGGCG CGGGGCGGCCGGCCAGGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 48, 3: 4016, 4: 3547} {0: 15, 1: 218, 2: 2558, 3: 4748, 4: 3746}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!