ID: 1066452802_1066452812

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1066452802 1066452812
Species Human (GRCh38) Human (GRCh38)
Location 10:35546873-35546895 10:35546926-35546948
Sequence CCAGTGAGCACTGACCTCTGCGG TGTAAAGGAGTGGAATCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 130} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!