ID: 1066452807_1066452808

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1066452807 1066452808
Species Human (GRCh38) Human (GRCh38)
Location 10:35546887-35546909 10:35546911-35546933
Sequence CCTCTGCGGAGAGCTTGGGAGGT GCAGCGCCTCATGTCTGTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 120} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!