ID: 1066452887_1066452900

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1066452887 1066452900
Species Human (GRCh38) Human (GRCh38)
Location 10:35547689-35547711 10:35547739-35547761
Sequence CCTGCCGGAGCCCTGTGTGGATG CATATGCCCATGATGCATTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 166} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!