ID: 1066458291_1066458296

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1066458291 1066458296
Species Human (GRCh38) Human (GRCh38)
Location 10:35590839-35590861 10:35590852-35590874
Sequence CCAAAGGCCCCACCTCCTCATAT CTCCTCATATCACATCACCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 20, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!