ID: 1066464891_1066464903

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1066464891 1066464903
Species Human (GRCh38) Human (GRCh38)
Location 10:35642343-35642365 10:35642359-35642381
Sequence CCGCCCCCAGCCCCGCGAGCCAA GAGCCAATCGCCGGGCGGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 463} {0: 1, 1: 0, 2: 0, 3: 2, 4: 22}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!