ID: 1066497972_1066497978

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1066497972 1066497978
Species Human (GRCh38) Human (GRCh38)
Location 10:35960708-35960730 10:35960742-35960764
Sequence CCTGCAACAGAGGGTCAGCGAAG AAGGAGGGATATTCCGAATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 100} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!