ID: 1066508166_1066508181

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1066508166 1066508181
Species Human (GRCh38) Human (GRCh38)
Location 10:36066547-36066569 10:36066595-36066617
Sequence CCCCTCTGAAACTTTGGGCACCA GGGCTGAGGATGGCTCTGCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 62, 4: 392}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!