ID: 1066550285_1066550290

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1066550285 1066550290
Species Human (GRCh38) Human (GRCh38)
Location 10:36548297-36548319 10:36548313-36548335
Sequence CCCTTCCTTAGAGCCTTTGTTCT TTGTTCTTATGGCATCATTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 353} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!