ID: 1066596720_1066596726

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1066596720 1066596726
Species Human (GRCh38) Human (GRCh38)
Location 10:37059150-37059172 10:37059177-37059199
Sequence CCTCAGCTCTACCCTCCCAGAGC AGTTCAATTGGAAGACAATCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!