ID: 1066597064_1066597071

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1066597064 1066597071
Species Human (GRCh38) Human (GRCh38)
Location 10:37062512-37062534 10:37062552-37062574
Sequence CCAGCGGGAGTTCCAGGTGGGCG CTGCATTGATTTAATAAAAAAGG
Strand - +
Off-target summary {0: 2, 1: 92, 2: 778, 3: 704, 4: 546} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!