ID: 1066693661_1066693666

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1066693661 1066693666
Species Human (GRCh38) Human (GRCh38)
Location 10:38058792-38058814 10:38058827-38058849
Sequence CCAAAACAAAGTGCCAGGACCAG ATGTGTTTTTGAGATACTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 273} {0: 1, 1: 0, 2: 3, 3: 28, 4: 297}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
659 14:60253422-60253444 CCTAAATAACGTGCCAGGATCAG - 14:60254104-60254126 ATGAAATCTTGAGATACTTAGGG +
12 10:38058792-38058814 CCAAAACAAAGTGCCAGGACCAG - 10:38058827-38058849 ATGTGTTTTTGAGATACTTAAGG +