ID: 1066701811_1066701817

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1066701811 1066701817
Species Human (GRCh38) Human (GRCh38)
Location 10:38137574-38137596 10:38137622-38137644
Sequence CCTGGTGTTTGGAAGGCCAGGTC AGACCTTTCACCCTTGAATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 412} {0: 1, 1: 0, 2: 1, 3: 5, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!