ID: 1066708117_1066708132

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1066708117 1066708132
Species Human (GRCh38) Human (GRCh38)
Location 10:38203169-38203191 10:38203220-38203242
Sequence CCATGTCCCAGCTGTGGACCTGT GAGGGAGAGCACAGCAACTGTGG
Strand - +
Off-target summary No data {0: 8, 1: 18, 2: 67, 3: 143, 4: 487}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!