ID: 1066708120_1066708126

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1066708120 1066708126
Species Human (GRCh38) Human (GRCh38)
Location 10:38203176-38203198 10:38203195-38203217
Sequence CCAGCTGTGGACCTGTGGTGAGG GAGGAGAGGGGCTACATGCTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!