ID: 1066731810_1066731815

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1066731810 1066731815
Species Human (GRCh38) Human (GRCh38)
Location 10:38443088-38443110 10:38443111-38443133
Sequence CCAGGGTCGTGGTGGTGTTGAGA GATGGTCAGAGGGGAGAAGTAGG
Strand - +
Off-target summary {0: 8, 1: 4, 2: 5, 3: 21, 4: 211} {0: 9, 1: 8, 2: 4, 3: 44, 4: 362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!