ID: 1066731810_1066731826

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1066731810 1066731826
Species Human (GRCh38) Human (GRCh38)
Location 10:38443088-38443110 10:38443140-38443162
Sequence CCAGGGTCGTGGTGGTGTTGAGA GGCCAGGGAGTTGCTGGGTGGGG
Strand - +
Off-target summary {0: 8, 1: 4, 2: 5, 3: 21, 4: 211} {0: 16, 1: 9, 2: 27, 3: 59, 4: 666}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!