ID: 1066927761_1066927765

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1066927761 1066927765
Species Human (GRCh38) Human (GRCh38)
Location 10:41719207-41719229 10:41719250-41719272
Sequence CCATTGGGAAGAACAAAATATCC AGCTATATGTTAAACTGCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 312} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!