ID: 1066966479_1066966481

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1066966479 1066966481
Species Human (GRCh38) Human (GRCh38)
Location 10:42270944-42270966 10:42270991-42271013
Sequence CCTTTTTTCTTCACCAAAAGCAG AATGACCCTTGAATGTTTCTAGG
Strand - +
Off-target summary {0: 6, 1: 0, 2: 3, 3: 28, 4: 398} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!