ID: 1066976425_1066976426

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1066976425 1066976426
Species Human (GRCh38) Human (GRCh38)
Location 10:42372210-42372232 10:42372236-42372258
Sequence CCATGAAAAAAGAAATCTAACAA ATACCCATCCAGAAGAGTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 83, 4: 917} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!