ID: 1067019820_1067019830

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1067019820 1067019830
Species Human (GRCh38) Human (GRCh38)
Location 10:42785543-42785565 10:42785595-42785617
Sequence CCCCCACCAATAGTGGTAGTGGT CTTTGATACAATGCCTCATTCGG
Strand - +
Off-target summary {0: 3, 1: 2, 2: 1, 3: 8, 4: 61} {0: 2, 1: 4, 2: 1, 3: 10, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!