ID: 1067022465_1067022466

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1067022465 1067022466
Species Human (GRCh38) Human (GRCh38)
Location 10:42813252-42813274 10:42813266-42813288
Sequence CCGTCTTTTGGTTTATTTAGACC ATTTAGACCATTTACATTTAAGG
Strand - +
Off-target summary No data {0: 44, 1: 3860, 2: 2786, 3: 1801, 4: 1551}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!