ID: 1067038112_1067038125

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1067038112 1067038125
Species Human (GRCh38) Human (GRCh38)
Location 10:42933862-42933884 10:42933909-42933931
Sequence CCTGCACCCCGCACGCCGTGCCC AAAGGTAGCCCAGCTGCAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 370} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!