ID: 1067048803_1067048809

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1067048803 1067048809
Species Human (GRCh38) Human (GRCh38)
Location 10:43000449-43000471 10:43000471-43000493
Sequence CCTTTCAGATGGCATTCATTGAA AGGGGCAAGTGGAAGAAGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 219} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!