ID: 1067068919_1067068932

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1067068919 1067068932
Species Human (GRCh38) Human (GRCh38)
Location 10:43118757-43118779 10:43118799-43118821
Sequence CCTCACCCAGTTCGGGGCTGGGC AGGAATGGACAGTGCATCCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 16, 4: 189} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!