ID: 1067079643_1067079649

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1067079643 1067079649
Species Human (GRCh38) Human (GRCh38)
Location 10:43205802-43205824 10:43205817-43205839
Sequence CCCTCCTGCAGCCCTGTCCAGCT GTCCAGCTCTACCACTCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 60, 4: 499} {0: 1, 1: 0, 2: 0, 3: 10, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!