ID: 1067082904_1067082918

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1067082904 1067082918
Species Human (GRCh38) Human (GRCh38)
Location 10:43221637-43221659 10:43221683-43221705
Sequence CCCTGCTGCATTTGCAGGTTAGG GGGGTGGGGGAAATCAGGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 44, 4: 468}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!