ID: 1067091160_1067091178

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1067091160 1067091178
Species Human (GRCh38) Human (GRCh38)
Location 10:43266520-43266542 10:43266561-43266583
Sequence CCCGCCGCGTGCGCTCCTGCCAC CGGCCCGCCAGGTGCCCTGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!