ID: 1067135653_1067135659

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1067135653 1067135659
Species Human (GRCh38) Human (GRCh38)
Location 10:43605461-43605483 10:43605480-43605502
Sequence CCCCCTGATTAATCTGCGCAAAC AAACAGTGCTGAGAGGGAAGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 46, 4: 432}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!