ID: 1067137795_1067137800

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1067137795 1067137800
Species Human (GRCh38) Human (GRCh38)
Location 10:43626597-43626619 10:43626620-43626642
Sequence CCCAGACTTGTGTATTACTTTTT AGCAGGGGTGTCCAATCATTTGG
Strand - +
Off-target summary No data {0: 2, 1: 144, 2: 438, 3: 743, 4: 799}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!