ID: 1067147196_1067147208

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1067147196 1067147208
Species Human (GRCh38) Human (GRCh38)
Location 10:43702409-43702431 10:43702453-43702475
Sequence CCGGCGCTGCCACCTGCCCATAT CAGCCTCCCCTGTACAGAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 174} {0: 1, 1: 0, 2: 2, 3: 24, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!