ID: 1067168313_1067168318

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1067168313 1067168318
Species Human (GRCh38) Human (GRCh38)
Location 10:43883039-43883061 10:43883074-43883096
Sequence CCCAGGGCAAGGCTTTCTCTAGT CCTCGAACTGTGTCAACCTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!