ID: 1067205768_1067205774

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1067205768 1067205774
Species Human (GRCh38) Human (GRCh38)
Location 10:44211501-44211523 10:44211551-44211573
Sequence CCCCCTCATGCTGCTTCTCCTGC AACTGCAAATTTTTTTAGACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 35, 4: 303}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!