ID: 1067214833_1067214838

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1067214833 1067214838
Species Human (GRCh38) Human (GRCh38)
Location 10:44293192-44293214 10:44293223-44293245
Sequence CCAGTGTACTTCTCCTGGGGGCT GGCCCACGGAAGCTCCGTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 149} {0: 1, 1: 0, 2: 0, 3: 4, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!