ID: 1067235622_1067235635

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1067235622 1067235635
Species Human (GRCh38) Human (GRCh38)
Location 10:44446177-44446199 10:44446222-44446244
Sequence CCCACCTCCTGCCGTGCAGCCTG AATTGGTACTGGTCTGTGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 17, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!