ID: 1067243609_1067243619

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1067243609 1067243619
Species Human (GRCh38) Human (GRCh38)
Location 10:44517495-44517517 10:44517531-44517553
Sequence CCACTCCTTCAAAGTCCACAGCC TCCTGGGGTGACCAGCTCTGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!