ID: 1067285583_1067285588

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1067285583 1067285588
Species Human (GRCh38) Human (GRCh38)
Location 10:44905420-44905442 10:44905461-44905483
Sequence CCTGACACCTGGTAACTTGAAAC CACAGTTTCTCAGGGTACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 160} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!