ID: 1067300195_1067300206

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1067300195 1067300206
Species Human (GRCh38) Human (GRCh38)
Location 10:45001013-45001035 10:45001055-45001077
Sequence CCTGCGTCGGATACTCGGGTCCG CAACGAGGGCGGCGCGGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 8} {0: 1, 1: 0, 2: 0, 3: 16, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!