ID: 1067372646_1067372652

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1067372646 1067372652
Species Human (GRCh38) Human (GRCh38)
Location 10:45699601-45699623 10:45699631-45699653
Sequence CCACTGTGTGGACTGTGAGACCC TAAGTGGGCCAGTTTGAACTTGG
Strand - +
Off-target summary No data {0: 10, 1: 1, 2: 2, 3: 10, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!