ID: 1067404661_1067404669

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1067404661 1067404669
Species Human (GRCh38) Human (GRCh38)
Location 10:46010714-46010736 10:46010755-46010777
Sequence CCTCCTCTACCTTACATGGGTCC CAATCCTCTGTAACCATGCTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 6, 4: 112} {0: 2, 1: 0, 2: 0, 3: 10, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!