ID: 1067404662_1067404674

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1067404662 1067404674
Species Human (GRCh38) Human (GRCh38)
Location 10:46010717-46010739 10:46010767-46010789
Sequence CCTCTACCTTACATGGGTCCTGA ACCATGCTGGGGGTGGACAATGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 1, 3: 7, 4: 89} {0: 1, 1: 2, 2: 2, 3: 18, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!