ID: 1067429481_1067429491

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1067429481 1067429491
Species Human (GRCh38) Human (GRCh38)
Location 10:46233730-46233752 10:46233761-46233783
Sequence CCTAAGACCTCATGGTCCCACCC CAGATGAAGTTGGGGCTGTTAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 19, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!